Isolation and culture of tissue

The collection of the examples used for research purposes in this study was approved by the particular Ethical Committee of The First Affiliated Hospital of Xi’ an Jiantong University, and written informed consent has been obtained from each donor. Menstrual blood (approximately 10  ml each) was collected from six healthy women (25– 30 years old) on the first day of menstruation utilizing a menstrual cup (Green Donna, GuangzhouMeiFanle Rubber Products, China). The samples were then transferred into a 50  ml centrifuge tube containing 10  ml of phosphate-buffered saline (PBS), penicillin (100 U/ml), streptomycin (100  mg/ml), zero. 25  mg/ml amphotericin B, and 2  mM ethylenediaminetetraacetic acid (EDTA) (Gibco, Grand Island, NY, USA). Monthly blood mononuclear cells were separated using Ficoll-Paque In addition (GE Healthcare, Amersham, UK) according to the manufacturer’ s directions. The cells were suspended in a T25 flask (Corning, Nyc, USA) containing DMEM/F12 supplemented with 10% foetal boeotian serum (FBS) (SiJiqing, China), streptomycin (100  mg/ml), plus penicillin (100 U/ml) and then cultured in a humidified incubator at 37  ° C in 5% CO 2 . The cell culture medium was transformed every 3  days. When the cells reached 90% confluence, they were detached using 0. 25% trypsin– EDTA plus passaged at a ratio of 1: 3.

MTT assay to judge cell proliferation

Cells from passages P3, P10, and P15 were seeded in 2 . 0  ×   10 3 cells/well in 96-well plates (Corning) and classy in DMEM/F12 supplemented with 10% FBS, streptomycin (100  mg/ml), and penicillin (100 U/ml). On each of the subsequent 7  days, MTT (5  mg/ml; Sigma-Aldrich, St Louis, MO, USA) was added to the cell medium simultaneously point, and the cells were then incubated at 37  ° C for an additional 4  h. A 150-μ l volume of dimethylsulfoxide (DMSO; Sigma-Aldrich) was then put into each well to terminate the reaction, and the blue– purple precipitate was lysed for 15  min while trembling the solution. Absorbance values were determined at 490  nm using an ELISA reader (Model 680; Bio-Rad, Hercules, CALIFORNIA, USA). The experiment was performed in triplicate.

Colony-forming assay

Freshly sorted cellular material were seeded at a very low seeding density (150 cells/cm 2 ) in fibronectin-coated (10  μ g/ml) 60-mm cell culture dishes and cultured within stromal medium containing DMEM/F12, 10% FBS, 2  millimeter glutamine, and 0. 5  mg/ml primocin at 37  ° C in 5% CO 2 . The medium was changed every 6– 7 days. Right after 14  days, the cells were fixed in methanol plus stained using Giemsa. Only colonies containing 50 or even more cells were defined as colony-forming units (CFU). The number of colonies was counted according to this definition.

Flow cytometry evaluation

To analyse surface gun expression using flow cytometry, adherent cells (1  ×   10 6 ) were gathered in 0. 02% EDTA, washed twice with PBS, and disaggregated into single cell suspensions by pipetting. The cells were incubated with 10  μ l from the following antibodies: fluorescein isothiocyanate (FITC)-conjugated mouse monoclonal antibodies against CD34, CD44, CD45, CD73, and CD90, plus phycoerythrin (PE)-conjugated mouse monoclonal antibodies against CD49, CD133, and CD146 (Biosciences, San Jose, CA, USA) from 4  ° C for 30  min. The cells had been then washed twice with PBS, resuspended in zero. 4  ml of PBS, and immediately analysed utilizing a FACS Calibur flow cytometer (Becton Dickinson, CA, USA). Cell Quest software was used for the data analysis.

Cytogenetic analysis

We used cytogenetic analyses to determine the karyotypes of MenSCs at P25. Following the MenSCs were treated with Colcemid, they were harvested using centrifugation and washed twice with PBS. Then, 75  millimeter KCl was added to the resuspended cells, and the combination was incubated for 20  min at 37  ° C. To this mixture, we added 7 drops associated with chilled methanol-acetic acid fixative. The mixture was after that centrifuged for 10  min at 4  ° D. The cell suspension was dropped onto a pre-cooled slide and allowed to air dry. The slides had been then observed under a microscope.

In-vitro differentiation

Cells were differentiated into adipogenic and osteogenic lineages to assess their differentiation capabilities in vitro .

To achieve adipogenic differentiation, cells were seeded at a density of 1  ×   10 4 cells/cm 2 . Following the cells reached 80% confluence, they were incubated in adipogenic differentiation medium for 3  weeks. The cells were after that fixed with 4% paraformaldehyde (Sigma-Aldrich) and stained along with Oil Red O (Sigma-Aldrich). The differentiation medium has been changed every 3  days. The adipogenic medium included DMEM/F12, 10% FBS, 10 − 6 mol/L dexamethasone, 0. 5  mmol/L isobutyl methylxanthine, 10  μ g/ml insulin, and 200  μ mol/L indomethacin (Sigma-Aldrich).

To achieve osteogenic differentiation, the cells were seeded at a density of 2  ×   10 3 cells/cm 2 . After 24  h, the moderate was replaced with osteogenic differentiation medium, and the tissues were induced for 2  weeks. The cells were after that fixed, and mineral deposition was visualized using Alizarin Red (Sigma Aldrich). The osteogenic medium contained DMEM/F12, 10% FBS, 10 − 8 mol/L dexamethasone, 10  mmol/L β -glycerol phosphoric acid solution, and 50  μ mol/L ascorbic acid (Sigma-Aldrich).

Each and every experimental endpoint, the cell types of the differentiated tissues were identified using RT-PCR analysis. The specific primers useful for these experiments are presented in Table 

1

.

Table 1

Primer list

SPARC

TACATCGCCCTGGATGAGTG

CACCTTGTCTCCAGGCAGAAC

PPARγ

GGCCAAGGCTTCATGACAA

AATGGGCTTCACATTCAGCAA

Runx2

TCCACACCATTAGGGACCATC

TGCTAATGCTTCGTGTTTCCA

FabP4

AGAGGATGATAAACTGGTGGTG

CGAACTTCAGTCCAGGTCAA

VEGF

CCTTGCTGCTCTACCTCC

AAATGCTTTCTCCGCTCT

FGF2

CTAACCGTTACCTGGCTATG

TTATACTGCCCAGTTCGTTT

IGF-1

AGGAAGTACATTTGAAGAACGCAAGT

CCTGCGGTGGCATGTCA

HGF

GATGTCCACGGAAGAGGAGA

GAGTCACCTTCCCTCGATGA

G-CSF

GACCCATGGCTGGACCT

ATGGGGAGGGCTTGGCT

GAPDH

GCACCGTCAAGGCTGAGAAC

TGGTGAAGACGCCAGTGGA

Reverse transcription and real-time qPCR

Total RNA was taken out from the cells using a RNA Fast 200 Kit (Aidlab Biotechnology, China) according to a standard protocol. One microgram associated with total RNA from each sample was used because the template for the reverse transcription reaction using a RevertAid Very first Strand cDNA Synthesis Kit (Fermentas, USA). Real-time qPCR was then performed using the cDNA with a SYBR Premix Ex Taq II (Takara, China) and a CFX-96 Current PCR Detection System (Bio-Rad, USA). The amplification response was performed using 40  cycles of the following problems: denaturation at 95  ° C for 5  h and annealing at 60  ° C for 30  s. All gene expression levels were normalized towards the level of the internal standard control, Gapdh, and analysed utilizing the 2 − Δ Δ Ct method. The specific primers used in these experiments are shown in Table  1 .

Fresh animals and animal model establishment

Female C57BL/6 mice aged 7– 8 weeks had been purchased from Xi’ an Jiaotong University Animal Lab. The experimental protocol was approved by the Ethical Panel and the Institutional Animal Care and Use Committee associated with Xi’ an Jiaotong University. The body weight of each computer mouse varied from 16 to 18  g and was written every day. Vaginal smears were obtained daily. The normal oestrous cycle in mice consists of the following four sequential phases: pro-oestrus, oestrus, metoestrus, and dioestrus. These stages had been determined based on the presence or absence of leukocytes, cornified epithelium, and nucleated epithelial cells [ 33 , 34 ]. Additionally , just mice that went through at least two consecutive normal oestrous cycles were included in the experiments.

Mice were intraperitoneally injected with cisplatin (CDDP; 2  mg/kg) for 7 consecutive days to create the POF model.

MenSC transplantation

The particular mice were randomly divided into the following three groupings: control group (normal mice without any treatment, n   =  10), POF group (POF mice, and   =  20), and MenSC-treated group (POF mice that were injected with 200-μ l cell suspension systems containing 2  ×   10 6 MenSCs on days 1 and 3 from the experiment, n   =  20). At 7 and 21  days right after treatment was begun, the animals were sacrificed, plus serum samples and ovaries were collected for following experiments.

Tracking GFP-labelled transplanted MenSCs

MenSCs were infected with green fluorescence proteins (GFP)-expressing lentiviral vectors (Genechem, China). The GFP-expressing MenSCs were cultured in DMEM/F12 supplemented with 10% FBS (SiJiqing). Before cell transplantation, GFP expression was validated in the MenSCs using a fluorescence microscope. The cells were trypsinized and washed twice with PBS, and the resulting cellular pellet was suspended in PBS to achieve a final denseness of 5  ×   10 6 cells/100  μ l. Using a Hamilton syringe, an overall total of 1  ×   10 7 GFP-labelled MenSCs in 200  μ l associated with PBS were evenly injected into the tail veins associated with POF mice. At 7 and 21  days right after injection, the mice were sacrificed, and frozen areas were made from the ovaries. These were used to investigate the particular morphologies and locations of GFP-MenSCs under a fluorescence microscope (Olympus, Japan). Nuclei were stained with DAPI.

Ria method of measuring serum hormone

To analyse ovarian function, collected serum samples had been used to measure hormone levels. We measured serum oestradiol (E2) and FSH levels using a [ 125 I]Oestradiol Radioimmunoassay Kit (JiuDing, China) and a [ 125 I]Human being FSH Radioimmunoassay Kit (JiuDing, China) according to a standard process.

Ovarian follicle counts and morphologic analysis

To analyse ovarian morphology, ovaries were collected from the three groups at 7 plus 21  days after MenSC transplantation and fixed within 4% paraformaldehyde for 12– 16  h. After the ovaries were fixed, they were dehydrated, paraffin-embedded, serially sectioned on 5  μ m thick, and mounted on glass microscope slides. Routine haematoxylin and eosin (H& E) discoloration was performed for histologic examinations, which were analysed below light microscopy. Follicles were categorized and counted in most fifth section through the ovary. Follicles were classified the following: a primordial follicle was an oocyte that was encircled by a single layer of squamous granulosa cells; an initial follicle was an intact, enlarged oocyte with a noticeable nucleus and one layer of cuboidal granulosa cells; another follicle possessed two or three layers of cuboidal granulosa tissue without antral space; early antral follicles contained rising antral spaces; and pre-ovulatory follicles, the largest of the follicular types, possessed a defined cumulus granulosa cell layer [ 35 ].

Apoptosis assay

In order to detect apoptosis in the collected ovaries, terminal deoxynucleotidyl transferase mediated dUTP nick end labelling (TUNEL) staining packages (Roche Applied Science, USA) were used according to the manufacturer’ s instructions. The nuclei were counterstained using DAPI. Images were collected under a fluorescence microscope (Olympus). The particular percentage of TUNEL-positive cells was determined by counting 5 random fields from each sample. The results are portrayed as the percentages of apoptotic cells in each area.

Conditioned medium administration in vivo

MenSCs at 80% confluence were switched in order to serum-free DMEM/F12 and cultured for an additional 48  l. The culture media were then collected as trained media (CM) and concentrated 10 times using ultrafiltration centrifuge tubes (molecular weight cut-off value: 3  kDa; Millipore, USA).

Female C57BL/6 mice were sorted into the three following groups: manage group (normal animals without any treatment, n   =  10), POF team (POF model, approximately 200  μ l of manage DMEM/F12 was injected through the tail vein, n   =  20), plus CM-treated group (POF model, approximately 200  μ d of concentrated CM was injected through the tail problematic vein, n   =  20). The mice were sacrificed 7  days right after treatment. The ovaries of the mice were removed to get H& E staining or TUNEL assays, and serum samples were collected to measure sex hormone amounts.

RNA interference

Fibroblast development factor 2 (FGF2) small interfering RNAs (siRNAs) plus negative transfection control siRNAs (NTC) were purchased through GenePharma (China). Cells were transfected with double-stranded siRNA oligonucleotides specific for FGF2 (sense sequence: 5′ -GGGCAGUAUAAACUUGGAUTT-3′, anti-sense sequence: 5′ -AUCCAAGUUUAUACUGCCCTT-3′ ). MenSCs were incubated with 50 nM siRNA for 6  h. Lipofectamine 2000 reagent (Invitrogen, USA) was used as the transfection reagent. The cells were then switched to fresh DMEM/F12 media. The CM were collected after 48  hrs of transfection and used for further experiments. The amount of FGF2 secreted from the MenSCs was measured using enzyme-linked immunosorbent assays (ELISAs).

Enzyme-linked immunosorbent assay

MenSCs were seeded at 5  ×   10 5 cells/well in six-well plates. Complete medium replacement was performed when the cellular material reached 80% confluence. After 48  h, the cells had been harvested and spun down in a centrifuge, and the supernatant was collected to measure the amount of FGF2 that was released according to the manufacturer’ s protocols (Ameko, China). Optical densities (OD) were measured at 450  nm using an ELISA plate reader (Bio-Rad, USA).

Statistical analysis

All analyses were performed using SPSS statistical software (version 15. 0; SPSS Inc., Chi town, IL, USA). The data are expressed as the mean  ±   SEM from at least three independent experiments. The value of differences between groups was assessed using visible analysis of variance (ANOVA), and P   <   0. 05 was considered to indicate statistical significance.