Isolation, culture, and expansion of hADSCs

hADSCs were isolated from human female abdominal adipose tissue obtained during Caesarean section. The adipose tissue was washed with Hank’s balanced salt solution (HBSS; Gibco). The washing step was repeated until all blood vessels and connective tissues appeared to have been liberated (usually three washes). The adipose tissue sample was minced into small pieces and digested in Dulbecco’s modified Eagle’s medium LG (DMEM-LG; Gibco) containing 1 mg/mL (w/w) collagenase Type I, and then incubated at 37 °C for 30 min with gentle shaking at 120 rpm. After the addition of fetal bovine serum (FBS; Gibco) to a final concentration of 10 % (v/v), the solution was filtered through a 100-μm filter (BD Falcon) to remove solid aggregates. The sample was subsequently centrifuged at 1500 rpm for 5 min at 4 °C. The pellet was washed twice with ice-cold HBSS and centrifuged at 1500 rpm for 5 min. The supernatant was removed and the cell pellet was resuspended in complete medium (DMEM-LG with 15 % FBS and 1 % antibiotic antimycotic solution) in a 75-cm2 culture dish and maintained in an incubator supplied with a humidified atmosphere of 5 % CO2 at 37 °C. After 2 days, non-adherent cells were removed by two or three washes with HBSS and adherent cells were further cultured in complete medium. The medium was changed every 2 days until the monolayer of adherent cells reached 80–90 % confluence. Cell passaging was performed using a 0.25 % trypsin solution (Sigma-Aldrich). Approximately 3 × 105 cells were used to inoculate a 75-cm2 culture dish and incubated at 37 °C and 5 % CO2.

Primary human hepatocyte isolation

Liver specimens were obtained from the margin of the macroscopically tumor-free liver tissue immediately after resection. Samples were taken under sterile conditions, transferred into ice cold (4 °C) William’s E medium, and human primary hepatocytes were immediately isolated under sterile conditions using collagenase. The liver specimen was washed twice with ice-cold HBSS. The washing step was repeated until all blood vessels and connective tissues appeared to have been liberated (usually three washes). The specimens were then cut into small pieces and digested with William’s E medium containing IV collagenase, and incubated at 37 °C for 30 min with gentle shaking at 120 rpm. After the completion of digestion, a final concentration of 10 % (v/v) FBS was added to stop the collagenase reaction. The resulting cell suspension was filtered through a 100-μm filter (BD Falcon) for the removal of solid aggregates. The filtered sample was subsequently centrifuged at 1500 rpm for 5 min at 4 °C. Finally, the cell pellets were washed with HBSS followed by another centrifugation (1500 rpm for 5 min at 4 °C).

Flow cytometry analysis

For flow cytometry detection of surface antigens, hADSCs (1 × 106 cells) were washed and resuspended in stain buffer (PBS; BD Biosciences) containing saturating concentrations (1:100 dilution) of the following conjugated mouse or rat monoclonal antibodies against human antigens (Biolegend) for 30 min in the dark at 2–8 °C: CD105-FITC, CD90-FITC, CD44-FITC, CD31-APC, CD34-PE, CD29-PE, CD45-PerCP/cy5.5, CD166-PE, HLA-DR-PE and FITC-CD90, CD105 labeled mouse IgG1k Isotype control, FITC-CD44 labeled Rat IgG2b k Isotype control, PerCP/cy5.5-CD45 labeled mouse IgG1 k Isotype control, APC-CD31 labeled mouse IgG1 k Isotype control, PE-CD29, 166 labeled mouse IgG1 k Isotype control, and PE-HLA-DR labeled Mouse IgG2a k Isotype control.

For intracellular staining of ALB and alpha-1-antitrypsin (AAT), 5 × 105 iHeps were harvested and fixed with 4 % paraformaldehyde for 30 min, and then permeabilized in staining buffer (BD) for 10 min. Cells were then incubated with primary antibody (Goat anti-human Albumin, Bethyl; Mouse anti-human AAT, Thermo) in staining buffer overnight at 4 °C, followed by secondary antibody (dylight 488 conjugated Donkey anti-goat IgG, Bethyl; dylight 594 conjugated Donkey anti-mouse IgG, Bethyl) incubation for 1 h at 37 °C. The cell suspensions were washed twice and resuspended in 300–500 μL PBS for flow cytometry (FACS Aria, BD Biosciences) using FLOWJO TM software (TreeStar, Inc., Ashland, OR, USA).

Adipogenic differentiation

Passage 3 hADSCs were counted and seeded at a density of 105 per well in a six-well plate. When the cells reached 100 % confluence, Adipogenic Differentiation Basal Medium A supplemented with 10 % FBS, 1 % penicillin-streptomycin, dexamethasone, isobutylmethylxanthine (IBMX), insulin, glutamine, and Rosiglitazone (Cyagen Biosciences) was added to four wells and complete culture medium (DMEM-LG) was added to other two wells as the negative controls. Three days later the medium was changed to hADSC Adipogenic Differentiation Basal Medium B, which contains 10 % FBS, dexamethasone, insulin, and glutamine (Cyagen Biosciences). The medium was changed 24 h later to medium A. Medium A and B were alternated 3–5 times (12–20 days), and then medium B was maintained for 4–7 days until the lipid droplets were big and round enough. During maintained culture, medium B was changed every 2–3 days with fresh medium B. Oil red O staining assessed the differentiation potential of adipogenesis formation of intracellular lipid droplets.

Osteogenic differentiation

Passage 3 hADSCs were harvested by trypsin digestion as described above; the cells were counted and seeded at a density of 105 per well in a six-well plate. When the cells reached 100 % confluence, MSC Osteogenic Differentiation Basal Medium containing 10 % FBS, 1 % penicillin-streptomycin, glutamine, ascorbate, β-glycerophosphate, and dexamethasone (Cyagen Biosciences) was added to four wells while complete culture medium was added to the other two wells as the negative controls. The medium was changed every 3 days for 3 weeks. The differentiation potential for osteogenesis was assessed by 40 mM Alizarin Red (pH 4.2) staining.

Chondrogenic differentiation

Passage 3 hADSCs were counted and seeded at a density of 106 per well in an ultra-low attachment six-well plate. When the pellet cultures contained 2.5 × 105 hADSCs, MSC Chondrogenic Differentiation Basal Medium, which consists of dexamethasone, ascorbate, sodium pyruvate, proline, TGF-β3, and insulin-transferrin-selenium (ITS; Cyagen Biosciences), was added to four wells and complete culture medium was added to the other two well as the negative controls. The medium was replaced every 3 days for 3 weeks. The differentiation potential for chondrogenesis was measured by Alcian blue staining.

Hepatic differentiation of hADSCs in vitro

hADSCs between passage 3 and 7 were planted at a density of 2–3 × 104 cells/cm2 on collagen I-coated dishes (Invitrogen) and cultured in expansion medium at 37 °C with 5 % CO2. Once the cells reached 100% confluence, they were incubated with 10 % FBS RPMI-1640 (Gibco) medium containing 1 μM ATRA for 24 h. The cells were then incubated with serum-free RPMI-1640 medium containing 100 nM IDE1, 3 μM CHIR99021, and 10 μM LY294002 (Selleckchem) for 24 h. Next, the cells were then incubated with serum-free RPMI-1640 medium containing 100 nM IDE1, 10 μM LY294002, 250 nM LDN-193189, and 20 ng/mL FGF4 (PeproTech) for 2 days and then changed to serum-free RPMI-1640 medium containing 100 nM IDE1, 10 μM LY294002, and 20 ng/mL FGF4 for 24 h. The medium was changed to Williams’ E (Gibco) supplemented with 150 ng/mL hepatocyte growth factor (HGF; Sino Biological), 20 ng/mL FGF4, 30 ng/mL oncostatin M (OsM; PeproTech), 2 × 10−5 mol/L dexamethasone (Dex, Sigma-Aldrich), and 1% ITS (Sigma-Aldrich). The differentiation medium was changed every 2 days.

Immunofluorescence

For immunofluorescent staining, the cells were fixed with 4 % paraformaldehyde for 15 min at room temperature, and then incubated with PBS containing 0.1 % Triton X-100 (Sigma-Aldrich) for 15 min. Cells were then washed three times with PBS. After being blocked by 5 % BSA in PBS for 1 h at room temperature, cells were incubated with primary antibodies at 4 °C overnight, washed three times with PBS, and then incubated with appropriate fluorescence-conjugated secondary antibody for 1 h at room temperature in the dark. Nuclei were stained with DAPI (Sigma-Aldrich). Primary and secondary antibodies were diluted in PBS containing 3 % BSA. Antibodies used for immunofluorescence were as follows: Goat anti-human Albumin (Bethyl, 1:200), Mouse anti-human AAT (Thermo, 1:40), dylight 488 conjugated Donkey anti-goat IgG (Bethyl, 1:200), dylight 594 conjugated Donkey anti-mouse IgG (Bethyl, 1:200), Rabbit anti-human AFP (Santa, 1:500), Mouse anti-human FOXA2 (Abcam, 1:250), Mouse anti-human hepatocyte (HepPar1) (Gene Tech, 1:20).

Reverse transcription-polymerase chain reaction (RT-PCR)

RNA (1 μg) was reverse transcribed into cDNA with the M-MLV Reverse Transcriptase (Promega) according to the manufacturer’s instructions. PCR was performed with HiFi Taq polymerase (TransGen). On completion of the PCR, products were examined on 1 % agarose gel. β-actin primers were used as an internal standard and amplifications of products were performed at 30 cycles. Primer sequences are provided in Table 

1

.

Table 1

Forward (F) and reverse (R) primer pairs used for polymerase chain reactions to detect hepatic specific gene transcripts in human adipose-derived stem cells, induced heaptocytes, and primary human hepatocytes

AAT

F: TGAGTTCGCCTTCAGCCTATACC

R: AGTCCTCTTCCTCGGTGTCCTT

ALB

F: GGTGAGACCAGAGGTTGATGTG

R: GCAGCAGCACGACAGAGTAATC

AFP

F: GCAGCCAAAGTGAAGAGGGAAGAC

R: GCAGACAATCCAGCACATCTCCTC

HNF4α

F: GGTGTCCATACGCATCCTTG

R: TGTCCGTTGCTGAGGTGAG

TDO2

F: CCGTAGAAGGCAGCGAAGAAG

R: GCTCCCTGAAGTGCTCTGTATG

CYP3A4

F: ATGGTCAACAGCCTGTGCT

R: CATGCTGTAGGCCCCAAAGA

TTR

F: GGCATCTCCCCATTCCATGA

R: TTCCTTGGGATTGGTGACGAC

CK18

F: ATGAGCTTCACCACTCGCTC

R: TGGCAATCTGGGCTTGTAGG

CK19

F: GCTTTGTGTCCTCGTCCTCC

R: TTGGCTTCGCATGTCACTCA

CK7

F: CCCAGACATCTTTGAGGCCC

R: TTCACGGCTCCCACTCCATC

human ALU

F: AATATGGCCCAACTGCAGAA

R: CATCGCATTTTCACATCCAA

β-actin

F: GGCATCGTGATGGACTCCG

R: GCTGGAAGGTGGACAGCGA

Real-time quantitative PCR

Total RNA was isolated from hADSCs, iHeps, and primary human hepatocytes (PHH) using the Trizol Reagent (Sigma-Aldrich). Quantitative real-time PCR was performed with SYBR Premix Ex Taq (TaKaRa) on the ABI StepOnePlus real-time PCR system (Applied Biosystems). All quantitative PCR data were obtained with at least two repeats. The PCR products were confirmed by proper melting curves. β-actin primers were used as an internal standard and amplifications of products were performed at 39 cycles. Primer sequences are provided in Table 

2

.

Table 2

Forward (F) and reverse (R) primer pairs used for polymerase chain reactions to detect hepatic specific gene transcripts in human adipose-derived stem cells, induced heaptocytes, and primary human hepatocytes

β-actin

F: TGGACTTCGAGCAAGAGATG

R: GAAGGAAGGCTGGAAGAGTG

CYP1A2

F: CTTCGCTACCTGCCTAACCC

R: GACTGTGTCAAATCCTGCTCC

CYP1A1

F: CAAGGGGCGTTGTGTCTTTG

R: GTCGATAGCACCATCAGGGG

CYP2A6

F: CAGCACTTCCTGAATGAG

R: AGGTGACTGGGAGGACTTGAGGC

CYP2B6

F: GCACTCCTCACAGGACTCTTG

R: CCCAGGTGTACCGTGAAGAC

CYP2C9

F: CTACAGATAGGTATTAAGGACA

R: GCTTCATATCCATGCAGCACCAC

CYP2D6

F: TGAAGGATGAGGCCGTCTGGGAGA

R: CAGTGGGCACCGAGAAGCTGAAGT

CYP3A4

F: TTCAGCAAGAAGAACAAGGACAA

R: GGTTGAAGAAGTCCTCCTAAGC

Western blot analysis

Western blotting was used to detect the presence of CK18, HNF4α, AFP, ALB, and AAT in iHeps. The cells were dissolved in the Mammalian Protein Extraction Reagent (Pierce, Rockford, IL, USA). Proteins were separated on an SDS-polyacrylamide gel and transferred to PVDF (polyvinylidine difluoride) membranes (BIORAD, Tokyo, Japan). Blots were saturated with 5 % skimmed milk in TBS-T for 1 h at room temperature, and afterwards incubated overnight with anti-human mouse monoclonal CK18 (Santa Cruz Biotechnology, Inc., CA, USA), rabbit polyclonal HNF4α (Santa Cruz Biotechnology, Inc.), rabbit polyclonal AFP (Santa Cruz Biotechnology, Inc.), mouse polyclonal ALB (Santa Cruz Biotechnology, Inc.), and rabbit polyclonal AAT (Abcam). Following washing in TBS-T, the membranes were incubated for 30 min with sheep anti-rabbit or anti-mouse IgG-HRP-linked whole antibodies (GE Healthcare Bio-Sciences KK, Tokyo, Japan). Monoclonal antibodies against human GAPDH were used as a control of protein loading (Protein Tech).

Periodic acid-schiff (PAS) staining

After 4 % paraformaldehyde fixation, cells were incubated for 5 min in 1 % periodic acid (Sigma, St. Louis, MO, USA) and washed with distilled water prior to incubation with Schiff’s reagent (Sigma) for 15 min. After a 5-min wash in tap water, cells were washed and visualized under a light microscope (CKX41; Olympus, Japan).

Indocyanine green and Oil Red O staining

For indocyanine green (ICG; Sigma-Aldrich) uptake assay, cells were changed to a medium with 1 mg/mL ICG and incubated at 37 °C for 1 h, followed by washing with PBS three times. For Oil red O staining, confluent cells were cultured in hepatic differentiation medium. After 10 days, cells were washed twice with PBS, fixed in 4 % formalin for 30 min, washed with PBS twice, followed by Oil Red O (Sigma-Aldrich) staining for 10 min, and then washed twice with 70 % ethanol and visualized under a light microscope (CKX41; Olympus).

Uptake of low-density lipoprotein assay

The uptake of low-density lipoprotein (LDL) was detected with the Dil-Ac-LDL staining kit (Biomedical Technologies, Stoughton, MA, USA). The assay was performed according to the manufacturer’s instructions. Briefly, cells were incubated in serum-free DMEM-LG containing 10 μg/mL 1,1′-dioctadecyl-3,3,3′,3′-tetramethy-lindocarbocyanine perchlorate acetylated-LDL (Dil-Ac-LDL) for 4 h at 37 °C. Cells were then washed and visualized under a fluorescence microscope (BX51; Olympus).

Albumin and alpha-1-antitrypsin ELISA

To determine the secretion of human ALB and AAT, supernatants of the cell culture were collected at different time points. For transplantation experiments, animal serum was collected. Levels of human ALB and AAT were measured by the human Albumin ELISA kit (Bethyl Laboratory) and the human α-1-antitrypsin ELISA kit (Bethyl Laboratory) according to the manufacturer’s instructions. Serum was diluted in a range from 10- to 10,000-fold to obtain values falling within the linear range of the standard curve.

Mice

The genetic background of the NPG mice (Beijing Vitalstar Biotechnology Co., Ltd.) was NOD-PrkdcscidIL2rgnull. For non-obese diabetes (NOD) mice, the phagocytic function of the macrophage for human cells was weak and the innate immune systems, such as the complement system and dendritic cell function, was significantly decreased. The Prkdcscid:Prkdc (protein kinase DNA-activated catalytic) gene mutation brings about the loss of T cells and B cells, which causes the severe combined immunodeficiency in both cellular and humoral immunity in mice (severe combined immune deficiency (SCID)). The IL2rgnull (interleukin-2 receptor gamma chain (IL-2Rγc), also known as CD132) is the common receptor subunit of cytokines, such as  IL-2, IL-4, IL-7, IL-9, IL-15 and IL-21, which has an important immune function. The mice immune function was severely reduced after knockout of this gene, the activity of natural killer (NK) cells was especially almost lost. All animal experiments were performed in accordance with institutional animal regulations.

iHep transplantation to CCl4-induced acute liver failure mice

NPG mice were injected with CCl4 (Sigma-Aldrich) at a dose of 0.5 mL/kg body weight by intraperitoneal injection. Eight hours after CCl4 treatment, hADSCs and iHeps (1 × 106 cells/animal, 300 μL) were intravenously injected into the mice. Meanwhile, control animals received an equal volume of PBS. Blood and liver samples were collected after the surviving animals were sacrificed. Blood samples were used for blood biochemical analysis. Livers of recipient mice were embedded in Tissue Freezing Medium (Leica) and then frozen in liquid nitrogen. Cryostat sections (8 μm) were stained.