Expression and purification of Oct4, Sox2, c-Myc, and Klf-4 protein factors

Oct4, Sox2, and c-Myc transcription factors were cloned into pET28a. Klf-4 was cloned into mammalian expression vector pcDNA 3.1. Fusion protein constructs in a pET28a background were transformed into Rosetta DE3 and selected on a LB agar with kanamycin (100 mg/l) plate at 37 °C overnight. The colonies were inoculated in 100 ml of LB-kanamycin and grown at 37 °C overnight. For expression, 10 ml of the overnight culture was inoculated into 1 l LB-kanamycin at 37 °C for 2–3 h until OD600 reached 0.6–0.8. IPTG was added to a final concentration of 0.5 mM, and the culture was incubated for another 16 h at 18 °C. Cells were harvested and stored at –20 °C. Unless otherwise indicated, all subsequent steps were performed at 4 °C. The cell pellet was suspended at 1:20 dilution on ice in buffer containing 20 mM Tris–Cl pH 8.5, 1 M NaCl, 1 mM EDTA, 0.1 mM PMSF, and 5 % glycerol. This suspension was sonicated at ~36 W, at 40-min intervals for 3 min until >90 % of the cells were broken. The cell lysate was centrifuged for 30 min at 8000 rpm to sediment cellular debris. The pellet was suspended at 1:20 dilution on ice in buffer containing 20 mM Tris–Cl, pH 8.5, 1 M NaCl, 8 M urea, 20 mM β-ME, and 20 mM imidazole at room temperature and gently stirred overnight. The suspended pellet was centrifuged at 18,000 rpm for 1 h at 12 °C and supernatant collected. The supernatant was loaded onto a 5-ml nickel column under denaturing conditions (buffer A: 20 mM Tris–Cl, pH 8.5, 1 M NaCl, 8 M urea, and 20 mM imidazole). Unbounded protein was washed with 20 column volumes of buffer A, and the bound protein was eluted with buffer B (20 mM Tris–Cl, pH 8.5, 1 M NaCl, 8 M urea, and 500 mM imidazole). DTT was added to the elution fractions to a final concentration of 5 mM followed by gentle stirring at 4 °C for 2–4 h.

For Klf-4 purification, pcDNA3.1-Klf-4 construct was transfected into FreeStyle™ 293-F cells in a spinner flask and cells were incubated on an orbital shaker platform at 125 rpm in a 37 °C incubator with humidity and 8 % CO2 for 48 h. Then 200 ml of transfected 293F cells were harvested and resuspended in 200 ml lysis buffer (50 mM Tris–Cl, pH 7.3, 150 mM NaCl, 1 % CA-630, aprotinin 1 μg/ml, leupetin 1 μg/ml, pepstatin 1 μg/ml, bestatin 1 μM, and 1 mM PMSF) and shaken on ice for 30 min. The cell lysate was centrifuged for 40 min at 14,000 rpm to sediment cellular debris. The supernatant was filtered through a 0.22 μM membrane and loaded onto a 5-ml DEAE column and the flow through was collected. This flow-through protein solution was loaded onto a 1-ml nickel column, washed with 40 mM imidazole and then eluted by elution buffer (50 mM Tris–Cl, pH 7.3, 150 mM NaCl, and 250 mM imidazole) with 50 column volumes in a 0–100 % gradient. Purified Klf4 was dialyzed into the storage buffer (20 mM Tris–Cl pH 8, 1 mM DTT, 100 mM NaCl, and 50 % glycerol) and stored at –80 °C.

Refolding of proteins and protein binding assay

The denatured Oct4, Sox2, and c-Myc eluate was diluted ~10-fold into pre-cooled refolding buffer (50 mM Tris–Cl, pH 8.5, 500 mM NaCl, 500 mM Arg, 0.1 % PEG4000, 0.1 mM EDTA, 1 mM GSH, and 0.1 mM GSSH) with gentle stirring to a final concentration of proteins between 0.05 and 0.1 mg/ml and was incubated at 4 °C for 48 h. The refolded protein was dialyzed against continuous exchange of fresh dialysis buffer (1 × PBS buffer, 5 mM β-ME, and 5 % glycerol) at 4 °C for 64 h. Refolded proteins were loaded onto a 1-ml nickel column and the target protein eluted with 100 % buffer B (buffer A: 1 × PBS buffer, 5 mM β-ME, 5 % glycerol, and 10 mM imidazole; buffer B: 1 × PBS buffer, 5 mM β-ME, 5 % glycerol, and 500 mM imidazole) in a 50 ml gradient. The refolded proteins were dialyzed against the storage buffer (1 × PBS buffer, 5 mM DTT, and 50 % glycerol) and stored at –80 °C. Oct4, Sox2, c-Myc, and Klf-4 were further tested for exonuclease, endonuclease, and endotoxin presence. DNA-binding activity of these protein factors was tested with electrophoretic mobility shift assays (EMSAs) using oligonucleotide duplexes representing the following sequences: Sox2, GAGACTTAATAACAAAGACCTGAAGCAGAGTCAG; Oct4, CTCGAGACTTAATAATTTGCATACCCTGAAGGCAGGAGTCAG; c-Myc, CTCGAGACTTAATACACGTGACCTGAAGGCAGAGTCAG; and Klf-4, CTGACTCTGCCTTCAGGTCACCCTATTAAGTCTCGAG.

The linear DNA fragments (100 nM) were incubated at 95 °C for 5 min in 1 × annealing buffer (10 mM Tris–Cl, pH 8.0, 50 mM NaCl, and 1 mM EDTA) and gradually cooled down to room temperature for annealing. For DNA binding reaction, 10 nM of the annealed oligonucleotides were incubated with the target proteins (2 μg) in 20 μl binding buffer (10 mM Hepes, pH 7.8, 5 mM MgCl2, 50 mM KCl, 0.5 mM DTT, and 1 % glycerol) at 26 °C for 1 h. Electrophoretic mobility assay was performed by adding 2 μl of 10 × gel loading dye (50 % glycerol and 10 % SYBR green dye) to the DNA protein mixture and 10 μl of each sample was analyzed using a native polyacrylamide gel (4 % acrylamide, 2.5 % glycerol, and 0.5 × TBE). The samples were resolved at 4 °C.

Generation of putative induced stem cells using HVJ envelope

The HVJ envelope (HVJ-E) transfection kit (GenomONE™) was purchased from Cosmo Bio Co., Ltd. Inactivation of HVJ has been confirmed for each lot by the viral proliferative potential rule-out test, using cultured cells and fertilized chicken eggs. Human fibroblasts were seeded at 2 × 10

5

cells per well in normal culture media (DMEM supplemented with 10 % FBS). On the next day, media were changed to fresh media supplemented with the HVJ-E transduction complex. After overnight culture, the protein transduction media were replaced by normal culture media, and cells were cultured for an additional 48 h before repeating the same protein transduction cycle. After three rounds of protein transduction, cells were passaged onto VTN-coated dishes at day 10 in iPSC culture media (Essential 8™ Medium; Invitrogen). Media were changed every 3–4 days and cultured for another 20 days (Fig. 

1b

).

Fig. 1

Characterization of recombinant Yamanaka transcription factors for transduction. a Recombinant refolded and purified Oct4, Sox2, c-Myc, and Klf4 were analyzed using denaturing Bis-Tris NuPage gel. Marker protein standards are shown in lane 1. b Schematic protocol depicting the process and timeline for generating iPMSCs. c Protein transduction and visualization in human fibroblasts 24, 48, 72, and 96 h post HVJ-E transduction of cells. Cells were stained with Hochest 33342 dye for nuclei (blue), and immunostained with anti-His antibody (green) for localization of the recombinant Yamanaka transcription factors. Merged images are shown for 24, 48, 72 and 96 h post transduction. d day, IPSC induced pluripotent stem cell

Localization of transfected reprogramming proteins

To determine the intracellular localization of transcription factors, protein-transduced cells were immunostained and examined by fluorescent microscopy. Cells were harvested 24, 48, 72 and 96 h post transduction, washed with PBS, and fixed in 4 % (v/v) formaldehyde in PBS at room temperature for 1 min. Cells were incubated with the diluted primary anti-his tag antibody (Novagen) at 1:1000 dilution at room temperature for 1 h. After washing three times with PBS, fluorescence-conjugated secondary antibody (anti-mouse IgG (H + L) Alexa Fluor® 488 Conjugate; CST) at 1:1000 dilution was added and incubated for 1 h at room temperature in the dark. Cells were again washed with PBS and nuclear DNA was stained by 1:3000 diluted Hoechst 33342 stain (Sigma-Aldrich). Images were captured by Olympus DP70 microscope.

Surface antigen analysis of putative induced stem cells

Cell surface antigens for human iPSCs were analyzed with FACS. Cells (1 × 105 cells per well) were incubated with one of the following primary antibodies: anti-CD24 antibody (Abcam), 1:100 dilution; anti-SSEA3 antibody (Abcam), 1:100 dilution; anti-CD105 antibody (Abcam), 1:200 dilution; anti-Nanog antibody (CST), 1:100 dilution; anti-Sox2 antibody (CST), 1:300 dilution; and anti-Oct4 antibody, 1:600 dilution (CST). After 1 h of incubation at 4 °C, the cells were washed, centrifuged, stained with 100 μl of a secondary antibody selected from anti-mouse IgG (H + L) Alexa Fluor® 488 Conjugate (CST) at 1:1000 dilution, anti-rat IgG (H + L) Alexa Fluor® 488 Conjugate (CST) at 1:1000 dilution, and anti-rabbit IgG (H + L) Alexa Fluor® 488 Conjugate (CST) at 1:1000 dilution. The stained cell pellets were suspended in 200 μl PBS/10 % FCS at 4 °C for flow cytometry analysis. All antibodies were validated for antigen specificity.

Immunofluorescence assays of putative induced stem cells and quantitative PCR

ALP staining was performed using the Alkaline Phosphatase Detection Kit (Millipore) as instructed by the manufacturer. Immunocytochemistry was performed using standard protocols. Briefly, cells were fixed using 4 % paraformaldehyde (PFA; Sigma-Aldrich), washed three times with PBS, and then incubated in PBS containing 0.3 % TritonX-100 (Sigma-Aldrich) and 5 % BSA for 1 h at room temperature. The cells were then incubated with primary antibody at 4 °C overnight: anti-CD24 antibody (Abcam), 1:100 dilution; anti-SSEA3 antibody (Abcam), 1:100 dilution; anti-CD105 antibody (Abcam), 1:200 dilution; anti-Tra1-60 (Millipore), 1:200 dilution; anti-Tra1-81 (Millipore), 1:200 dilution; anti-Nanog antibody (CST), 1:100 dilution; anti-Sox2 antibody (CST), 1:300 dilution; and anti-Oct4 antibody (CST), 1:600 dilution.

After washing three times with PBS, cells were incubated with secondary antibodies: anti-mouse IgG (H + L) Alexa Fluor® 488 conjugate (CST), 1:1000 dilution; anti-rat IgG (H + L) Alexa Fluor® 488 conjugate (CST), 1:1000 dilution; and anti-rabbit IgG (H + L) Alexa Fluor® 488 conjugate (CST), 1:1000 dilution. Nuclei were detected by Hoechst 33342 (Sigma-Aldrich) staining. Images were captured using an Olympus DP70 digital camera. Isotype controls are shown in Additional file 1: Figure S1.

Total RNA was extracted using TRIZol® Reagent (Life Technologies) followed by cDNA synthesis using M-MuLV Reverse Transcriptase and Oligo (dT)23VN (NEB). Quantitative PCR (qPCR) was performed with iTaq™ Universal SYBR® Green Supermix (Bio-Rad) using the primers presented in Table 

1

and RT-PCR was performed for gene expression studies using the primers presented in Table 

2

. All antibodies were validated for antigen specificity.

Table 1

Primers for quantitative PCR reactions

β-actin

CATGTACGTTGCTATCCAGGC

CTCCTTAATGTCACGCACGAT

Klf4

CCCACATGAAGCGACTTCCC

CAGGTCCAGGAGATCGTTGAA

Nanog

TTTGTGGGCCTGAAGAAAACT

AGGGCTGTCCTGAATAAGCAG

c-Myc

GGCTCCTGGCAAAAGGTCA

CTGCGTAGTTGTGCTGATGT

Sox2

GCCGAGTGGAAACTTTTGTCG

GGCAGCGTGTACTTATCCTTCT

Oct4

CTGGGTTGATCCTCGGACCT

CCATCGGAGTTGCTCTCCA

ABCG2

CAGGTGGAGGCAAATCTTCGT

ACCCTGTTAATCCGTTCGTTTT

hTERT

TAATGGGCTCCTTTCACCTG

CAGTGCGTCTTGAGGAGCA

Insulin

GCAGCCTTTGTGAACCAACAC

CCCCGCACACTAGGTAGAGA

Pdx1

ATCTCCCCATACGAAGTGCC

CGTGAGCTTTGGTGGATTTCAT

Nkx6.1

GGACTGCCACGCTTTAGCA

TGGGTCTCGTGTGTTTTCTCT

C/EBPα

CTTCAGCCCGTACCTGGAG

GGAGAGGAAGTCGTGGTGC

PPARγ

GGGATCAGCTCCGTGGATCT

TGCACTTTGGTACTCTTGAAGTT

Table 2

Primers for RT-PCR reactions

β-actin

AGAGCTACGAGCTGCCTGAC

AGCACTGTGTTGGCGTACAG

PPARγ

TTCAGCAGCGTGTTCGACTT

AGGAATCGCTTTCTGGGTCA

C/EBPα

CTAACTCCCCCATGGAGTCGG

GTCGATGGACGTCTCGTGC

CollagenI

GATGGATTCCAGTTCGAGTATG

GTTTGGGTTGCTTGTCTG TTTG

CbfaI

GATGACACTGCCACCTCTGA

GACTGGCGGGGTGTAAGT

Osteocalcin

ATGAGAGCCCTCACACTCCTC

CGTAGAAGCGCCGATAGGC

Osterix

TAATGGGCTCCTTTCACCTG

CACTGGGCAGACAGTCAGAA

Bone Sialo protein

TCAGCATTTTGGGAATGGCC

GAGGTTGTTGTCTTCGAGGT

Osteonectin

AGTAGGGCCTGGATCTTCTT

CTGCTTCTCAGTCAGAAGG

Nestin

AGCTGGCGCACCTCAAGATG

AGGGAAGTTGGGCTCAGGAC

GFAP

GAGGCGGCCAGTTATCAGGA

GTTCTCCTCGCCCTCTAGCA

Whole genome bisulfite sequencing and bioinformatics analysis

Genomic DNA was extracted from 5000 CD24+ or fibroblast cells using the SDS/Proteinase K/Phenol chloroform method [15]. Then 20 pg of unmethylated lambda DNA was spiked into 20 ng of iPMSC genomic DNA. The combined DNA was sheared to 200 bp fragments using a Covaris sonicator. Fragmented DNAs were end-repaired, dA-tailed, and ligated to a methylated NEB Illumina adaptor using the NEBNext® Ultra™ DNA Library Prep Kit for Illumina (E7370S; NEB). Adaptor ligated DNA was bisulfite converted using the EZ DNA Methylation Kit (Zymo Research). Libraries were enriched by PCR using a mutated version of Q5 polymerase that can read DNA templates containing dU (New England Biolabs) and sequenced on the Illumina NextSeq 500 platform with 150 bp paired-end reads. Libraries were made in duplicate. Two high-output runs were carried out.

Adaptor trimmed sequencing reads were mapped to hg19 and bacterial phage lambda genomic sequences and CpG methylation levels were extracted using Bismark [16]. CpG sites with at least two reads covered in two replicate libraries were included in the downstream analysis. CpG methylation levels in genomic regions were obtained by the local likelihood smoothing function in the bsseq R package [17]. Differential methylation between CD24+ and fibroblast cells was analyzed using t statistics. Regions with a mean differential methylation level higher than 0.1 were defined as differentially methylated regions (DMRs).

DMRs were annotated to the UCSC RefGene table, and their distribution in genomic elements including promoter, 5′ UTR, exon, intron, intergenic, 3′ UTR, TTS, and repetitive sequences was calculated using HOMER [18]. Fold enrichment of DMRs in specific genomic elements and the distance of DMRs to their closest TSS were also calculated using HOMER. Then 60,000 genomic regions, each with a length of 200 bp, were randomly sampled three times from the human genome hg19, and these three random datasets were used as controls when analyzing the distance of DMRs to TSS.

Genes harboring at least one DMR (DMR genes) within the ±2 kb region of TSS were used for gene-set enrichment analysis, since DNA methylation changes located in the TSS or flanking regions are more likely to affect gene expression. A total of 866 genes were investigated for enrichment within the MSigDB database (gene set CGP: chemical and genetic perturbations) using a hypergeometric distribution model and p values were corrected to FDR (q value) with the Benjamini-Hochberg method [19]. Interaction networks of genes enriched in each gene set were constructed using GeneMANIA [20].

Directed in-vitro differentiation

The pluripotency of stem cells was examined by directed in-vitro differentiation. For adipogenic differentiation (mesoderm), stem cells were induced in the medium (10 % FBS/DMEM, 500 μM IBMX, 1 μM dexamethasone, 10 μg/ml insulin, and 200 μM indomethacin) for 3 weeks, with media changed every third day. For osteogenic differentiation (mesoderm), iPMSCs were induced in the medium (10 % FBS/DMEM, 50 μM l-ascorbic acid, 10 mM β-glycerophosphate, and 0.1 μM dexamethasone) for 2 weeks, with media changed every third day. For neurogenic differentiation (ectoderm), iPMSCs were first preincubated in 20 % FBS/DMEM, 1 mM β-mercaptoethanol (BME), and 10 ng/ml basic fibroblast growth factor (bFGF; Invitrogen) for 24 h, and then induced in 2 μM valproic acid, 10 μM forskolin, 1 μM hydrocortisone, and 5 μg/ml insulin for 1 week, with media changed every third day. For pancreatic islet differentiation [2123]: day 1, RPMI (without FBS), activin A (100 ng/ml), and Wnt3a (25 ng/ml); days 2–3, RPMI with 0.2 % vol/vol FBS and activin A (100 ng/ml); days 4–6, RPMI with 2 % vol/vol FBS and FGF-10 (50 ng/ml); days 7–9, DMEM with 1 % vol/vol B27 supplement, cyclopamine (0.25 μM), all-trans retinoic acid (RA, 2 μM), and Noggin (50 ng/ml); and days 10–12, DMEM with 1 % vol/vol B27 supplement.

Immunofluorescence assay, PCR, and western blotting of differentiated iPMSCs

Induced osteogenic cells were fixed by 4 % paraformaldehyde (Sigma-Aldrich) and stained by anti-osteocalcin antibody (1:200 dilution; Santa Cruz); induced neurogenic cells were stained with anti-GFAP antibody (1:300 dilution; CST), anti-Nestin antibody (1:300 dilution; CST), anti-MAP2 antibody (1:200 dilution; Abcam), and anti-β-Tubulin III (1:200 dilution; Abcam); and induced pancreatic islet cells were stained with anti-Pdx1 antibody (1:400 dilution; CST), anti-glucagon antibody (1:400 dilution; CST), and anti-insulin antibody (1:400 dilution, 3014; CST) respectively. Total RNA was extracted using TRIZol® Reagent (Life Technologies) followed by cDNA synthesis using M-MuLV Reverse Transcriptase and Oligo (dT)23VN (NEB). qPCR was performed with iTaq™ Universal SYBR® Green Supermix (Bio Rad). Western blotting was performed for osteocalcin, microtubule-associated protein 2 (MAP2), β-Tubulin III, ADFP, and Plascidin L. All antibodies were validated for antigen specificity.

Glucose-stimulated insulin secretion assay

To determine whether cells could respond to glucose in vitro [24], the differentiated cells were preincubated for 4 h at 37 °C in Krebs–Ringer bicarbonate HEPES (KRBH) buffer of the following composition: 129 mM NaCl, 5 mM NaHCO3, 4.8 mM KCl, 1.2 mM KH2PO4, 1.2 mM MgSO4, 2.5 mM CaCl2, 10 mM HEPES, and 0.1 % (wt/vol) BSA at pH 7.4.

For high glucose-induced insulin release, cells were incubated in KRBH buffer supplemented with different concentrations of glucose (3.3 mM and 16.7 mM) together with 10 μM tolbutamide (Sigma) for 2 h at 37 °C. The concentration of insulin secreted into the culture media was measured using a human insulin enzyme-linked immunosorbent assay (ELISA) kit (CSB-E05069h; CUSABIO).

Directed in-vivo differentiation on scaffold

Adipogenic iPMSCs and polyglycolic (PGA) fibro scaffold contracts were implanted subcutaneously on the backs of nude mice. Osteogenic iPMSCs and porous β-tricalcium phosphate (β-TCP) scaffold contracts were also implanted subcutaneously on the backs of nude mice. Eight weeks after implantation animals were sacrificed, and the cell scaffold constructs were harvested and fixed in freshly prepared 4 % paraformaldehyde in PBS.

Histochemistry and immunohistochemistry assay

Following paraformaldehyde fixation, the scaffolds were embedded in paraffin. Ten micron tissue sections were cut using RM2235 radial microtomes (Leica Microsystems) for histological analysis and stained with hematoxylin and eosin (H & E). In the osteogenic group, tissue sections were also stained by a modified Masson Trichrome [25] and Von Kussa [26] staining. Five mice from each group were analyzed. Immunohistochemistry staining of HLA-ABC (CST) at 1:1000 dilution were used to detect whether the tissue formed in vivo originated from human iPMSCs. Sections were observed under an AX80 microscope (Olympus, Tokyo, Japan).

Teratoma formation

Reprogrammed iPMSC suspensions (1 × 107) were mixed with matrigel (BD Bioscience) and injected subcutaneously into NOD/SCID mice without anesthesia. After 2 months teratomas were collected and fixed in 4 % paraformaldehyde in PBS, embedded in paraffin, and sectioned at 10 μm using RM2235 radial microtomes (Leica Microsystems). Sections were subjected to histologic staining with H & E and immunohistochemistry staining of HLA-ABC as already described and observed under an AX80 microscope (Olympus).