Cell culture and preparation of conditioned medium

Human term placentas were obtained from individuals who underwent elective cesarean section at 38 weeks of gestation. All participants were healthy Japanese women aged 31–37 years. Patients with a history of infection (including that by human immunodeficiency virus, hepatitis B virus, hepatitis C virus, or syphilis), underlying diseases (diabetes, hypertension, or regular use of medication), or obstetric complications (pregnancy-induced hypertension, threatened premature delivery, placenta praevia, or gestational diabetes) were excluded from this study. The study protocol was approved by the Ethics Committee for Clinical Research at the Tokyo Medical and Dental University (#1102). All study participants provided written informed consent.

PlaMSCs were isolated from the chorionic plate and villous chorion of term placentas (n = 8) following previously described methods with some modifications [14, 16]. The phenotype of the PlaMSCs was characterized by flow cytometric analysis of cell surface antigens, including tests for cluster of differentiation (CD)11b, CD31, CD34, CD44, CD45, CD73, CD90, and CD105. PlaMSCs were detached from culture dishes using 0.05% Trypsin/0.53 mM EDTA (Wako Pure Chemical Industries, Ltd, Tokyo, Japan), washed, and added to polystyrene tubes with a filter top (BD Bioscience, Heidelberg, Germany). The cells were incubated with either antigen-specific antibodies or isotype controls for 15 min on ice. Excess antibodies were removed by washing the cells with phosphate-buffered saline (PBS). Flow cytometric analyses were conducted on the BD FACSAria cytometer (BD Bioscience), using BD FACSDiva software.

To evaluate the differentiation potential of PlaMSCs, osteogenic, adipogenic, or chondrogenic differentiation was induced using osteogenic, adipogenic, or chondrogenic differentiation media (hMSC Differentiation BulletKit; Lonza, Walkersville, MD, USA), respectively, according to the manufacturer’s instructions. Human umbilical vein endothelial cells (HUVECs) were purchased from Lonza, and cultured on collagen-coated dishes (Iwaki, Shizuoka, Japan) in Endothelial Cell Growth Medium 2 (EGM2; Lonza). Human bone marrow-derived MSCs (BMMSCs) were purchased from Lonza, and cultured in MSC growth medium MSCGM (Lonza). CM was prepared using methods described previously [14]. Briefly, PlaMSCs were cultured in MSCGM, and the medium was changed to serum-free Dulbecco’s modified Eagle’s medium (D-MEM; Thermo Fisher Scientific, Waltham, MA, USA) when the cells reached ~ 80% confluence. The CM was collected after 48 h of incubation.

Recovery and characterization of exosomes

Exosomes were recovered from the CM by ultracentrifugation according to methods described previously [14, 17]. Briefly, the CM was centrifuged at 2000 × g for 10 min at 4 °C. The supernatant was next passed through a 0.2-μm filter (Steradisc; Kurabo, Bio-Medical Department, Tokyo, Japan). Next, the filtrate was ultracentrifuged at 100,000 × g for 70 min at 4 °C (Optima XE-90 ultracentrifuge with a swing rotor, SW41Ti; Beckman Coulter, Inc., Brea, CA, USA). The precipitate was next rinsed with PBS and ultracentrifuged at 100,000 × g for 70 min at 4 °C. The exosome-enriched fraction was next reconstituted in PBS or D-MEM, for further studies. The protein concentration of the exosome fraction was measured using a Micro BCA Protein Assay Kit (Thermo Fisher Scientific), according to the manufacturer’s instructions. The yield of the exosome preparation was 5.8 × 1011–7.6 × 1011 particles/106 cells, as determined by the electrical resistance nano pulse method (qNano; IZON Science Ltd., Oxford, UK).

CD63 is located on the limiting membranes of exosomes and MVBs; therefore, PlaMSCs were transfected with a plasmid encoding for a CD63–green fluorescent protein (GFP) fusion protein (pCT-CD63-GFP; System Biosciences, Mountain View, CA, USA) to visualize intracellular CD63 as described previously [18]. Transmission electron microscopy (TEM) was used to observe exosome morphology (Hitachi H-7100 microscope; Hitachi High-Technologies Corporation, Tokyo, Japan). The samples were prepared by dropping 4 μl of exosome solution onto a formvar-coated copper grid for 2 min at 25 °C (RT), and the samples were negatively stained with 1.5% uranyl acetate for 2 min. For immunoelectron microscopy, the samples were prepared by dropping 4 μl of exosome solution onto a formvar-coated nickel grid for 30 min at RT, and fixed in 4% paraformaldehyde in 0.1% phosphate buffer. After rinsing in 0.1 M Tris–HCl buffer, the samples were incubated with blocking solution (5% goat serum albumin) for 20 min. We next incubated the samples overnight with either anti-human CD63 antibody (1:40 dilution in 0.1 M Tris–HCl buffer; Becton, Dickinson and Company, Franklin Lakes, NJ, USA) or anti-human calnexin antibody (1:50 dilution; Proteintech Group, Inc., Rosemont, IL, USA) as positive and negative controls, respectively. After rinsing in 0.1 M Tris–HCl buffer three times, the samples were incubated with secondary antibody conjugated with 10-nm gold particles (British Bio Cell International, Cardiff, UK) for 1 h. After rinsing in 0.1 M Tris–HCl buffer, the samples were negatively stained, as already described. To evaluate particle size of exosomes, dynamic light scattering (DLS) measurements were performed using a Zetasizer Nano ZS instrument equipped with temperature control (Malvern Instruments Ltd, Malvern, UK).

Western blot analysis

Western blotting was performed to assess for exosome marker presence. Exosomes (equivalent to 1.0 μg protein) were solubilized in sample buffer (3% sodium dodecyl sulfate, 10% glycerol, 0.05 M Tris–HCl, and 0.001% bromophenol blue) without a reducing agent for 30 min at room temperature, and separated on a 10% acrylamide gel in parallel with a molecular marker (Prestained XL-Ladder Broad, SP-2120; Apro Life Science Institute Inc., Tokushima, Japan). Proteins were then transferred to polyvinylidene difluoride membranes (Bio-Rad, Hercules, CA, USA). The membranes were blocked with 5% skim milk in Tris-buffered saline with Tween 20 overnight at 4 °C. The membranes were next incubated with a mouse anti-human CD9 IgG1 primary antibody solution (1:200 dilution; Santa Cruz Biotechnology, Santa Cruz, CA, USA) for 1 h at room temperature. The membranes were next incubated with a goat anti-mouse IgG horseradish peroxidase-conjugated secondary antibody (Millipore, Billerica, MA, USA) for 45 min at room temperature. Next, the membranes were incubated with the Luminata Forte substrate (Millipore), and visualized using an ImageQuant LAS 4000 mini imager (GE Healthcare, Little Chalfont, UK).

Incorporation of exosomes

The incorporation of exosomes was examined using labeled exosomes. Exosomes were labeled with a PKH67 green fluorescent membrane linker dye (Sigma Aldrich, St. Louis, MO, USA) according to the manufacturer’s instructions. HUVECs were seeded in six-well cell culture plates (Asahi Glass Co., Ltd, Tokyo, Japan) at a cell density of 2 × 105 cells/well. After a 24-h incubation, the cells were cultured in serum-free alpha-modified minimum essential media (αMEM; Thermo Fisher Scientific, Inc., Waltham, MA, USA) with the labeled exosomes (equivalent to 5.0 μg of protein) or control solution (the fluorescent membrane linker dye without exosomes). After another 24-h incubation, HUVECs were fixed in 4% paraformaldehyde (PFA) solution, and the nuclei were counterstained with Hoechst 33342. The labeled exosomes in the HUVECs were observed under a fluorescence microscope (DMI6000 B; Leica, Wetzlar, Germany) or analyzed by flow cytometry (FACSAria; BD Bioscience). The incorporation of PlaMSC exosomes (PlaMSC-exo) was independently confirmed by fluorescence microscopy or flow cytometry at least three times.

Endothelial tube formation assay

The angiogenic activity of PlaMSC-CM or PlaMSC-exo was assessed using an in-vitro angiogenesis assay kit according to the manufacturer’s instructions (Kurabo). Either CM or exosomes was added to culture, and the endothelial cell tubes were stained with anti-human CD31 antibody and alkaline phosphatase-conjugated secondary goat anti-mouse IgG antibody after 11 days of culture. The effects of CM or exosomes on the endothelial tube formation were confirmed in the range between positive (VEGFA) and negative control (suramin). The number of endothelial cell tubes that intersected with the criteria grid (provided in the kit) was counted to quantify the effect of PlaMSC-CM or PlaMSC-exo on angiogenesis. D-MEM (n = 4), BMMSC-CM (n = 4), PlaMSC-CM (n = 4), and PlaMSC-exo (n = 4) were assaigned for the endothelial tube formation assay. All experiments were conducted independently, at least three times each.

Cell migration assay

The migration of endothelial cells was evaluated using a scratch wound healing assay. HUVECs (8 × 104 cells/well) were plated on six-well collagen type I-coated culture plates (Asahi Glass) and grown to confluence. A wound was generated by manually scratching the cell surface with a pipet tip. Subsequently, pictures of the wound area in the presence or absence of PlaMSC-exo (equivalent to 0–5.0 μg of protein) were taken under a microscope (BZ-8000; Keyence, Osaka, Japan) every 3 h for 12 h. Wound area filling by migrating cells was analyzed 12 h after treatment using the National Institutes of Health (NIH) ImageJ software at three selected points (upper, mid, and lower portions of the wound). All experiments were conducted as at least three independent replicates.

Growth factor array

The growth factor profiles in CM prepared from BMMSCs or PlaMSCs (denoted BMMSC-CM and PlaMSC-CM, respectively) were evaluated using a multiplex growth factor array system (Human Growth Factor Antibody Array I; RayBiotech, Inc., Norcross, GA, USA). The CM was concentrated 17-fold using an ultrafilter (Amicon Ultra, 10 kDa; Millipore). The volume of the concentrated CM was calibrated according to cell numbers when the CM was collected. Colorimetric analysis using a luminescent image analyzer (ImageQuant LAS 4000 mini) was used to quantify the intensity of each membrane dot, which allowed for the assessment of growth factor content in the CM. The experiments were conducted three times using BMMSC-CM or PlaMSC-CM prepared from PlaMSCs of different patients.

Gene expression

Fetal bovine serum (FBS) was ultracentrifuged at 200,000 × 

g

for 16 h at 4 °C to deplete exosomes. HUVECs were plated in six-well culture plates at a cell density of 2 × 10

5

cells/well in EGM2. At 70% confluence, the medium was changed to αMEM containing 5% exosome-depleted FBS, and the cells were precultured for 1 h. Next, the cells were incubated with or without exosomes (equivalent to 5.0 μg of protein) for another 72 h. In the control culture, an equivalent volume of PBS was added to the medium. Total RNA was prepared from cells using the RNeasy Mini Kit (Qiagen, Venlo, the Netherlands). Complementary DNA (cDNA) was synthesized from 1.0 μg of total RNA using a First Strand cDNA Synthesis Kit (AMV; Roche, Mannheim, Germany). The mRNA expression levels of human vascular endothelial growth factor receptor 2 (VEGFR2), human Tie-2, human angiopoietin-2 (Ang-2), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were measured by quantitative reverse transcription-polymerase chain reaction (qRT-PCR). qRT-PCR was conducted using LightCycler FastStart DNA Master SYBR Green I reaction mix. Amplification and quantification of amplified products were performed in a LightCycler instrument (Roche). Reaction products were quantified using LightCycler Software Version 4.1 (Roche). Primer sets, annealing temperature, and references (ref) used in this study (GAPDH [

14

], VEGFR2, Tie2, and ANg-2 [

19

]) are presented in Table 

1

. Each experiment was independently repeated three times.

Table 1

Primers used for qRT-PCR

GAPDH

ACCACAGTCCATGCCATCAC

TCCACCACCCTGTTGCTGTA

58

15

VEGFR2

CCAAGAACTCCATGCCCCTTA

ATCCCTGGGATCTGAAACG

58

20

Tie-2

TAGAGCCTGAAACAGCATACCAGG

CTATTGGAATGGCAAATGCTGGG

61

20

Ang-2

AGCAGAAAGGATGGAGACAAC

CTTGAGCGAATAGCCTGAGC

58

20

In-vivo angiogenesis assay

All animal study protocols and procedures were approved by the Animal Care Ethics Committee of the Tokyo Medical and Dental University (0170325A). All experiments were carried out in accordance with the approved guidelines by Science Council of Japan for proper conduct of animal experiments. The in-vivo proangiogenic activity of CM, exosome-depleted CM (CM-exo), or exosomes was evaluated using a murine auricle ischemia model. Six nude mice (8 weeks old, male) were used for the analyses in each assay. One day before exosome infusion, the proximal region on both sides of the auricular vasculature was occluded percutaneously by a 10–0 surgical suture. The CM, CM-exo, or exosomes (50 μl/day) were infused subcutaneously into the right auricles using a syringe with a 32-gauge injection needle for 2 consecutive days. PBS was injected into the auricles as a control. Superficial blood flow in the auricles was measured by laser Doppler blood flow analysis (moorLDI Laser Doppler Imager, moorLDI software version 5.1; Moor Instruments, Axminster, UK) under general anesthesia (1.5% isoflurane, 150 ml/min) before infusion (day 0), and 3 and 6 days after the second infusion. For histological analysis, the auricles were excised 3 days after the infusion of PlaMSC-exo and fixed in 4% PFA. The tissues were frozen in Tissue-Tek O.C.T. compound (Sakura Finetek USA, Inc., Torrance, CA, USA), and sectioned along the craniocaudal axis into sections 8 μm thick in a cryostat at –20 °C. The sections were stained with Mayer’s hematoxylin and eosin (HE). The histological examination was conducted under a fluorescence microscope (BZ-8000; Keyence).

Statistical analysis

The proangiogenic activity of CM was compared to that of the control using Dunnett’s test (Fig. 2a). To assess the effect of exosome depletion of PlaMSC-CM, pairwise comparisons were made using the Tukey–Kramer adjustment for multiple comparisons (Fig. 4a). To compare the proangiogenic effect of PlaMSC-CM with that of PlaMSC-exo, Tukey–Kramer adjustments were used for multiple comparisons (Fig. 4b). The effect of PlaMSC-exo (0.2, 1.0, and 5.0 μg) compared to that of the control (0 μg) on endothelial cell migration was evaluated at 12 h using Dunnett’s test (Fig. 4c). To evaluate the effect of PlaMSC-exo on angiogenic gene expression in endothelial cells (HUVEC), Student’s t tests were used to compare mean values (Fig. 4e). To assess the proangiogenic effect of PlaMSC-exo in vivo, differences in blood flow values (Flux-PU) between day 0 and day 3 or 6 were evaluated. The mean Flux-PU of the PlaMSC-exo group was compared to that of the control using a paired Student’s t test (Fig. 5a). P < 0.05 was considered statistically significant.