Animals

Six- to eight-week-old male C57BL/6 mice were bought from Sippr-BK Laboratory Animal Corporation (Shanghai, China). The particular mice were fed food and water ad libitum plus housed under standard conditions with a 12  h lighting and 12  h dark cycle. All animal tests were approved by the Laboratory Animal Center of The Tabs of Animal Experimental Ethical Inspection of the First Associated Hospital, College of Medicine, Zhejiang University.

Cellular culture

MenSCs were remote and maintained as previously described [ 4 , 12 ]. The particular MenSCs were collected and cultured in Chang Moderate (S-Evans Biosciences, Hangzhou, China). The MenSCs used in the particular experiments were at the fourth to eighth passage.

The mouse AML12 hepatocyte cellular line was generously provided by the Stem Cell Financial institution of the Chinese Academy of Sciences. AML12 cells had been cultured in DMEM/F12 (Gibco, Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; Gibco), 100  IU/mL of penicillin (Sigma-Aldrich, St . Louis, MO, USA), 100  μ g/mL of streptomycin (Sigma-Aldrich), insulin, transferrin, selenium (ITS) Liquid Media Supplement (Sigma-Aldrich, USA) plus 40  ng/ml dexamethasone (Sigma-Aldrich, USA).

Identification of MenSCs using flow cytometry

The particular expression of isolated MenSCs surface markers was examined using fluorescence-activated cell sorting (FACS). Briefly, 5  ×   10 5 cells had been collected and washed twice with stain buffer (BD Biosciences, San Jose, CA, USA). MenSCs were incubated in the dark for 20  min with the following primary antibodies: PE-conjugated CD29, CD34, CD45, CD73, CD90, CD105, CD117, and HLA-DR (Becton Dickinson, Franklin Lakes, NJ, USA). The stained cells were washed twice with spot buffer, resuspended in 500  μ l of spot buffer and then analyzed using a FC500 flow cytometer (Beckman Coulter, Brea, CA, USA). IgG1 (Becton Dickinson, Franklin Lakes, NJ, USA) was used as an isotype manage for the anti-CD29, anti-CD34, anti-CD45, anti-CD73, anti-CD90, anti-CD105, plus anti-CD117 antibodies. IgG2a (Becton Dickinson) was used since the isotype control for the anti-HLA-DR antibody. The results were examined using FlowJo software (Tree Star, Inc., Ashland, OR EVEN, USA).

CFU-F assay

The colony-forming unit-fibroblast (CFU-F) assay was determined because described previously [ 26 ]. MenSCs plated at fifty, 150, or 250 cells per square centimeter. Right after 15  days of culture, cells were stained with twenty percent crystal violet solution for 15  min at area temperature. After phosphate-buffered saline (PBS) wash, the amounts of individual colonies were counted. Three independent experiments had been performed.

Isolation and identification of MenSC-Ex

When MenSCs reached 70– 80% confluence, the cells were cultured for an additional 24  h. The particular conditioned medium was collected and centrifuged at 2000  g for 20  min to remove dead cells plus cell debris. The supernatant was filtered through a zero. 22-μ m pore filter (EMD Millipore, Billerica, MOTHER, USA) and concentrated according to a 30 KDa molecular weight cutoff (MWCO) (EMD Millipore) by centrifugation on 4000  g for 60  min. A 1/5 amount of ExoQuick-TC Exosome Precipitation Solution (System Biosciences, Inc., Palo Alto, CA, USA) was added to the supernatant plus it was incubated overnight. The mixture was centrifuged from 1500  g for 30  min, which aspirated the particular supernatant, and spun down at 1500  g meant for 5  min to remove residual ExoQuick-TC. The exosome-enriched small fraction was diluted with 100  μ l PBS plus stored at -80  ° C. The protein content material of the concentrated exosomes was determined using a BCA proteins assay kit (Pierce, Waltham, MA, USA). MenSC-Ex had been identified using transmission electron microscopy. The MenSC-Ex had been confirmed to express the exosome marker tetraspan molecules [CD63 (Abcam, Cambridge, UK) and tsg101 (Abcam)] using Western blot analysis.

Cellular subscriber base and in vivo tracking of MenSC-Ex

MenSC-Ex were labeled with a 1: 10 proportion of Exo-Green (System Biosciences, Inc. ). The exosomes solution was incubated at 37  ° C just for 10  min. A 100  μ l volume of ExoQuick-TC was added to stop the labeling reaction. The tagged MenSC-Ex were placed on ice (or at 4  ° C) for 30  min and centrifuged for 3  min at 14, 000  rpm to remove the supernatant, which contained excess label. The pellet containing the particular labeled MenSC-Ex was resuspended in 500  μ t of PBS, and at least 100  μ l from the solution of labeled MenSC-Ex was added to approximately 1  ×   10 5 AML12 cells in one well of a 6-well culture plate, that was incubated for 24  h. AML12 cells were incubated with 100  μ l of PBS instead of MenSC-Ex as the control. The cellular uptake of MenSC-Ex has been observed under a confocal laser microscope (Carl Zeiss, Oberkochen, Germany).

XenoLight DiR (Perkin Elmer, Waltham, MA, USA) was used to track exosomes in vivo. The solution of XenoLight DiR was diluted to 300  μ M in PBS. We additional the diluted XenoLight DiR solution to 10  μ gary the gadget guy of MenSC-Ex in 1  ml PBS to obtain a last concentration of 2  μ M. The cells were incubated with MenSC-Ex at room temperature for 30  minutes. A 1/5 volume of ExoQuick-TC Exosome Precipitation Solution (System Biosciences, Inc. ) was then added to the supernatant for 30  min. The solution was then centrifuged to get 3  min at 14, 000  rpm. The pellet, which contained the fluorescently labeled MenSC-Ex, was resuspended in 100  μ l of PBS. We after that systemically administered 50  μ g of MenSC-Ex with the tail vein. IVIS analysis (Caliper Life Sciences, Hopkinton, MA, USA) and dissections were performed after 3  h and 6  h.

Antibody arrays

Human Cytokine G1000 arrays (AAH-CYT-G1000; RayBiotech, Norcross, GA, USA) were used according to the manufacturer’ s instructions to measure the expression levels of 120 cytokines in the MenSCs and MenSC-Ex. Positive signals were taken on glass chips using a laser scanner (GenePix 4000B Microarray Scanner; Molecular Devices, Sunnyvale, CA, USA), as well as the observed fluorescence intensities were normalized to the intensities from the internal positive controls. These cytokines were screened utilizing the following integrated conditions: the MenSC group compared to the MenSC-Ex group ( p   <   0. 05) for samples with fluorescence intensity values that exceeded 300 (RayBiotech). Differentially indicated proteins were arranged using hierarchical clustering and displayed as a heat map. The heat map was generated making use of R software ( http://www.r-project.org/ ).

Cell proliferation and apoptosis evaluation

A Cell Counting Kit-8 (CCK-8, Dojindo, Kumamoto, Japan) was used to evaluate expansion in MenSC-Ex-treated D-GalN/LPS-induced AML12 cells. After the cells had been cultured for 24  h with 44  μ g/ml D-GalN and 100  ng/ml LPS, the CCK-8 reagent was added to the chamber, and the cells were incubated for an additional 3  h according to the manufacturer’ s process. The optical densities of the solutions were read from 450  nm (OD450) and measured using a multifunctional microplate reader (SpectraMax M5, Molecular Devices).

To analyze cell apoptosis, MenSC-Ex-treated AML12 cells which were cultured for 24  h with 44  μ g/ml D-GalN and 100  ng/ml LPS were collected, centrifuged, and then stained with propidium iodide and Annexin Sixth is v in the dark for 30  min at room temperature utilizing a cell apoptosis Analysis Kit (Sigma-Aldrich). Cell apoptosis has been then analyzed using flow cytometry.

The animal model plus MenSC-Ex transplantations

To stimulate FHF in mice, C57BL/6 mice (20  ±   2  g) were intraperitoneally injected with D-GalN (800  mg/kg) (Sigma-Aldrich) and LPS (50  μ g/kg) (Sigma-Aldrich). Mice injected with an equal volume of PBS alone had been used as the model group for the FHF model ( n   =  ten per model group). To evaluate the therapeutic efficacy associated with MenSC-Ex on FHF, 1  μ g/μ l associated with MenSC-Ex in PBS or PBS alone was shot into the tail veins of mice 1  day prior to treatment. The animals were anesthetized using sodium pentobarbital (50  mg/kg; Solarbio Bioscience & Technology, Shanghai, China) 6  hours after treatment with D-GalN/LPS. The serum samples were centrifuged at 3000  rpm for 10  min to collect clear serum to detect the levels associated with alanine aminotransferase (ALT) and aspartate aminotransferase (AST). Some of liver tissue was stored in 4% paraformaldehyde regarding histological and immunohistochemical analysis. The remainder of the tissue examples was washed in cold saline and preserved with -80  ° C for further analysis using reverse transcription-polymerase chain reaction (RT-PCR). The survival rates of the rodents were determined for the 12  h period following D-GalN/LPS challenge.

Liver function tests and ELISA

Liver function was assessed by examining serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels. ALT and AST levels were measured making use of commercial kits (Nanjing Jiancheng Bioengineering Institute, Jiangsu, China) according to the manufacturer’ s instructions.

The levels of interleukin-6 (IL-6), interleukin-1β (IL-1β ), plus tumor necrosis alpha (TNF-α ) were measured within serum samples using commercially available enzyme-linked immunosorbent assays (ELISAs) (RayBiotech) according to the manufacturer’ s instructions.

Histological, immunohistochemistry and TUNEL staining

Liver organ tissues were harvested from mice 6  h right after treatment with D-GalN/LPS or MenSC-Ex. Tissues were set in 10% buffered formalin, embedded in paraffin, sectioned to a 5-mm thickness, and stained with hematoxylin plus eosin (H& E). The sections were imaged utilizing an Olympus IX83 inverted microscope (Olympus, Tokyo, Japan) pre-loaded with Olympus cellSens software (cellSens Standard 1 . 9).

To perform the immunohistochemistry test, peroxidase activity was blocked by incubating the sections within 3% H 2 O two for 10  min. The sections had been then pretreated via heat-mediated antigen retrieval with salt citrate buffer (pH6. 0). The tissue sections had been blocked in 10% FBS for 20  min on room temperature and then incubated with rabbit polyclonal antibodies against mouse caspase-3 (Cell Signaling Technology, Danvers, MOTHER, USA) overnight at 4  ° C. The slideshow were washed three times with PBS for 5  minutes and subsequently incubated with secondary antibodies (Abcam). An answer of diaminobenzidine tetrahydrochloride (DAB kit; Maixin Biotech, Fujian, China) was used as the reaction substrate.

Apoptosis was detected in liver cellular material in paraffin-embedded sections using a fluorescence terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) apoptosis assay kit (Vazyme, Nanjing, China) according to the manufacturer’ s instructions. Stained areas were observed and photographed using an Olympus IX83 upside down microscope equipped with Olympus cellSens software. The number of positive tissue was counted in six randomly selected fields for each slide.

DNA fragmentation analysis

Genomic DNA was extracted from liver samples based on the instructions supplied by the manufacturer of the DNA Ladder kit (Beyotime, Jiangsu, China). The DNA was then electrophoresed inside a 1 . 5% agarose gel, which was stained with zero. 1  g/ml ethidium bromide at 140  V designed for 20  min.

Isolation of liver mononuclear tissues

Liver mononuclear cells (MNCs) were isolated and prepared as previously described [ 27 ]. Briefly, the livers of C57BL/6 mice had been passed through a 70-μ m stainless steel mesh. The brought on cells were resuspended in 40% Percoll (Sigma-Aldrich), carefully lain over 70% Percoll and centrifuged at 2000  g for 20  min at room temperature. The particular MNCs were contained in and isolated from the interphase. Liver organ MNCs were stained using anti-mouse CD11b, CD3, NK1. 1, and F4/80 antibodies (Biolegend, San Diego, CA, USA) and subjected to FACS analysis.

Quantitative real-time RT-PCR

Quantitative real-time RT-PCR (qRT-PCR) was used to analyze mRNA expression levels using a CFX96 Real-time PCR Detection Program (Bio-Rad, Hercules, CA, USA). These experiments were carried out according to a previously described protocol [

28

]. Quickly, the reaction consisted of 1  μ L of cDNA, 6. 2  μ L of RNAse-free water, 10  μ L of SYBR® Fast qPCR Master Mix (Takara Bio Inc., Mountain View, CA, USA), and zero. 4  μ L of each gene-specific primer (10  mM). The primer sequences are shown in Table 

1

. The relatives quantities of each PCR product were determined using the subsequent equation: RQ  =  2

-Δ Δ CT

. GAPDH served as an inner control.

Table 1

Primers utilized for qRT-PCR analysis

GAPDH-F

AATGGATTTGGACGCATTGGT

Computer mouse

GAPDH-R

TTTGCACTGGTACGTGTTGAT

IL-6-F

GGCGGATCGGATGTTGTGAT

Mouse

IL-6-R

GGACCCCAGACAATCGGTTG

IL-1β -F

GTACATCAGCACCTCACAAG

Mouse

IL-1β -R

CACAGGCTCTCTTTGAACAG

TNF-α -F

ACTCCCAGAAAAGCAAGCAA

Computer mouse

TNF-α -R

CGAGCAGGAATGAGAAGAGG

Caspase-3-F

TACCGGTGGAGGCTGACT

Computer mouse

Caspase-3-R

GCTGCAAAGGGACTGGAT

Western blot analysis

After MenSCs were collected, the cells and MenSC-Ex had been homogenized using cell lysis buffer (Cell Signaling Technology) containing 100× phenylmethylsulfonyl fluoride (PMSF) (Beyotime Biotechnology Incorporation., Shanghai, China). Twenty micrograms of total protein had been obtained from MenSCs and MenSC-Ex and placed in separate lane to be separated using electrophoresis on NuPAGE® Novex 10% Bis-Tris gels (Life Technologies, Carlsbad, CA, USA). The particular separated proteins were then transferred onto PVDF walls (EMD Millipore). The membranes were blocked in zero. 5% bovine serum albumin (BSA) for 1  they would at room temperature and then incubated with primary antibodies at 4  ° C overnight. They were subsequently incubated with HRP-conjugated secondary antibodies (goat anti-mouse or goat anti-rabbit, Bio-Rad) for 1  h at room temperatures. Immunoreactive bands were visualized using enhanced chemiluminescence (ECL) reagent (Bio-Rad) with a Tanon-4500 digital image program (Tanon Science & Technology, Shanghai, China).

Statistical evaluation

All statistical analyses had been performed using GraphPad Prism v5. 0 (GraphPad Software program Inc., San Diego, CA, USA). All data represent the particular means  ±   standard deviation. One-way analysis associated with variance (ANOVA) was used to determine differences between organizations. P values  <   0. 05 (*) or  <   0. 01 (**) were considered to indicate statistical importance.