Animals

Healthy male C57/BL6 mice were housed in standard polycarbonate cages in the Animal Facility of Soochow University. Animals were maintained on a 12-hour light/dark cycle as well as provided with free access to feed and water. All animals received humane care in accordance with the Guidelines for the Care and Use of Research Animals established by Soochow University.

Type 1 diabetes and hindlimb ischemia induction

Type 1 diabetes was induced by intraperitoneal injections of streptozotocin (Sangon Biotech, Shanghai, China). Male C57/B6 mice (4–6 weeks of age) received an injection of citrate buffer (4.92 mol/ml sodium citrate, pH 4.2–4.5) or streptozotocin (50 mg/kg) dissolved in sterile citrate buffer for 5 days consecutively. The blood glucose level was measured 7, 14, and 21 days after the injection. Mice with a blood glucose level > 12.0 mmol/L were considered diabetic and selected for experiments.

Three weeks after diabetes induction, all nondiabetic and diabetic mice received unilateral hindlimb artery devascularization. Mice aged 6–8 weeks were anesthetized with 160 mg/kg pentobarbital by intraperitoneal injection. During the operation, the superficial and deep femoral vessel, the common femoral vessel and its abdominal branches were ligated and excised to generate hindlimb ischemia as described previously [15]. The right femoral artery was exposed but not dissected to serve as the nonischemic control.

Groups and curcumin treatment

Animals were divided equally into four groups. Twenty mice were used in this study, namely five mice for each group. In the nondiabetes group, mice with euglycemia were treated with 300 μl of sterile saline by lavage once a day for 14 days. In the diabetes with saline treatment group, sterile saline (300 μl) was applied to diabetic mice by lavage once a day for 14 days. In the diabetes with olive oil treatment group, totally 300 μl of extra virgin olive oil was administrated by lavage to each mouse once a day for 14 consecutive days. In the diabetes with curcumin treatment group, 1000 mg/kg curcumin (Sigma-Aldrich, St. Louis, MO, USA) in 300 μl of olive oil was applied to mice once a day for 14 days.

Laser Doppler perfusion imaging

Laser Doppler perfusion imaging (LDPI) (Perimed Instruments AB, Stockholm, Sweden) was conducted on mice immediately, 7 days, and 14 days after ischemic surgery. LDPI was used to measure the blood flow recovery ratio in ischemic hindlimbs:

$$ mathrm{Blood};mathrm{flow};mathrm{recovery};mathrm{ratio}=frac{mathrm{Ischemic};mathrm{limb};mathrm{perfusion};left(mathrm{left};mathrm{hindlimb}right)}{mathrm{Nonischemic};mathrm{limb};mathrm{perfusion};left(mathrm{right};mathrm{hindlimb}right)}times 100% $$

Colored histogram pixels indicated the blood reperfusion of ischemic and nonischemic limbs.

In-vivo capillary density measurement

The capillary density indicates the angiogenesis in the ischemic hindlimb. Generally, mice were sacrificed 14 days after hindlimb ischemic surgery to collect ischemic muscle samples, namely the left gastrocnemius muscle. Then muscle samples were embedded in OCT compound (Sakura, Torrance, CA, USA), frozen by liquid nitrogen, and cut by Leica CM 1950 Cryomicrotome (Carl Zeiss AG, Jena, Germany) at a thickness of 6 μm. Frozen sections were first washed in phosphate-buffered saline (PBS), and then stained with diluted fluorescein-IB4 (Invitrogen, Carlsbad, CA, USA) at room temperature for 1 hour. Samples were then washed in PBS again and sealed with a coverslip. A fluorescent microscope (Olympus, Tokyo, Japan) was used to examine the images.

EPC isolation and characterization

After ischemic muscle samples were collected, the bones were then separated for EPC isolation. The purified EPCs would be used directly for the following functional determination with no other treatment. The protocol of EPC isolation and culture was described previously [16, 17]. After the muscle sample was collected, the bones were then separated and smashed to collect bone marrow mononuclear cells (BM-MNCs). The bone sample includes hipbones, femurs, and tibiae, as well as shoulder bones, ulnas, vertebra, and sternum. EPCs were further isolated by layering the BM-MNCs on a density gradient (Histopaque 1083; Sigma) followed with centrifugation and were cultured in Endothelial Cell Basal Medium-2 (EBM-2; Lonza, Basel, Switzerland), supplemented with EGM-2 MV SingleQuots (Lonza). After 2 days of culture in a 37 °C, 5% CO2 incubator, nonadherent cells were washed off by PBS while adherent cells were further incubated in fresh EBM-2 for 1 week before experiments.

Culture medium was gently washed off by PBS, and then cells were cultured in 5 μg/ml of DiI-Ac-LDL solution (Biomedical Technologies Inc., Stoughton, MA, USA) in EBM-2 for 4 hours at 37 °C, with the dish wrapped in aluminum foil. The cells were then fixed by 4% paraformaldehyde (PFA)/PBS for 20 min at 37 °C. After this, the cells were washed by PBS and DAPI staining solution (Beyotime Biotechnology, Shanghai, China) was added to stain the nuclei. After 10 min of incubation, staining solution were washed off by PBS and the sample was ready to be observed by fluorescent microscope.

EPC tube formation assay

The tube formation assay was carried out as described previously to determine the in-vitro tube incorporation potential of EPCs [18, 19]. Briefly, human umbilical cord-derived endothelial cells (HUVECs; 1 × 104 cells/well) and DiI-labeled (Invitrogen, Eugene, OR, USA) EPCs (1 × 103 cells/well) were first resuspended using EBM-2 (100 μl), then seeded together on a 96-well plate, with 50 μl Matrigel matrix (BD, Bedford, MA, USA) added to each well beforehand, and incubated for 30 min at 37 °C. A fluorescent microscope was used to take morphology images, to count the number of DiI-labeled cells, and to measure the tube length.

EPC transwell assay

A modified Boyden chamber assay was used to examine the EPC migration activity [20]: 500 μl of 15% FBS/Dulbecco’s modified Eagle’s medium (DMEM; Gibco, New York, NY, USA) was added into the lower chamber. EPCs (1 × 104 cells/well) in 200 μl serum-free medium were placed in the upper chamber, with 0.05–0.2% bovine serum albumin (BSA; Amresco, Englewood, CO, USA) in order to maintain the osmotic pressure. The chamber was incubated for 4 hours under 5% CO2 at 37 °C. Cells on the lower side of the chamber were fixed with PFA and stained with DAPI. The number of migrated cells was counted using a fluorescent microscope.

EPC senescence detection

EPC senescence was evaluated based on the quantity of senescence-associated β-galactosidase (SA-β-gal)-positive cells. SA-β-gal was stained using the senescence β-galactosidase staining kit (Beyotime Biotechnology, Shanghai, China), according to the manufacturer’s instructions [21]. The number of SA-β-gal-positive cells was determined by counting blue cells from at least 1000 cells per field.

Colony-formation assay

Methylcellulose-based medium (MethoCultM3236; Stem Cell Technologies, Vancouver, BC, Canada) was prepared with supplements as follows: VEGF (50 ng/ml; PeproTech, Rocky Hill, NJ, USA), SCF (100 ng/ml; PeproTech), IL-3 (20 ng/ml; PeproTech), EGF (50 ng/ml; PeproTech), bFGF (50 ng/ml; PeproTech), IGF-1 (50 ng/ml; PeproTech), and 30% FBS. EPCs were cultured in this medium for 14 days under 5% CO2 at 37 °C. A phase-contrast microscope (Olympus) was used for manual quantitative counting.

Real-time reverse-transcriptase PCR analysis

Real-time reverse-transcription polymerase chain reaction (RT-PCR) was used to determine the mRNA expression of VEGF and Ang-1 in EPCs and hindlimb muscle. Total RNA was extracted using Trizol reagent (Ambion by Life Technologies, Carlsbad, CA, USA) and then purified according to the manufacturer’s protocol (QIAGEN, Valencia, CA, USA). cDNA was converted from extracted total RNA using the PrimeScript RT reagent kit (TAKARA, Tokyo, Japan). Then, 2 μl of cDNA sample was used as a template for quantitative real-time PCR (RT-qPCR). qPCR was performed using Power Syber Green (Applied Biosystems, Foster City, CA, USA) and the StepOne-Plus real-time PCR system (Applied Biosystems) according to the manufacturer’s guidelines. The endogenous housekeeping gene

GAPDH

was used to normalize the results. The sequences of primers used in qPCR are presented in Table 

1

. The 2

−ΔΔCT

method was used to evaluate the relative quantification of changes in the expression of target genes [

22

].

Table 1

Primer sequences for quantitative real-time PCR

mVEGF-A

AGCACAGCAGATGTGAATGC

AATGCTTTCTCCGCTCTGAA

mANG-1

ATCTTGATAACCGCAGCCAC

TGTCGGCACATACCTCTTGT

GAPDH

TGTGTCCGTCGTGGATCTGA

ACCACCTTCTTGATGTCATCATACTT

Statistical analyses

All results are expressed as mean ± SD. The data were analyzed using GraphPad Prism 6.0 software, via Student’s unpaired t test for the difference between two groups or one-way ANOVA with Bonferroni correction for multiple group comparison. Differences were considered significant at P < 0.05.