Stem cell acquisition and lifestyle

Human ASCs obtained from abdominal fat (n  =  3, age 30– 54 years) were purchased from Catholic MASTER Cells (Seoul, Korea). All experiments were performed with the ASCs from 3 different donors (age 30– 54 years). The research process was granted by the Institutional Review Board of Seoul St . Mary’ s Hospital. The cells (P2– 3, 1 ) 5– 3  ×   10 3 /cm 2 ) were cultured within growth medium, which consists of low-glucose Dulbecco’ s customized Eagle medium (DMEM; Gibco, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS; Gibco) and 1% antibiotic-antimycotic solution (Invitrogen, Grand Island, NYC, USA) until the cells reach 80– 90% confluency in the humidified 5% CO 2 incubator at 37  ° C.

CG loading

All experiments were performed with 2– 3 passaged ASCs. ASCs (P2– 3, 1  ×   10 5 cells/mL) had been transferred to a new 15  mL conical tube and centrifuged at various gravitational forces (0, 300, 600, 1200, 2400, and 3600  g) for various durations (0, 5, 15, 30, and 60  min) using a centrifuge (1580MGR, Gyrozen, Seoul, South Korea). After CG launching, the cells were re-plated onto a 60  mm tradition dish in monolayer and incubated until the desired period points in growth medium.

Chondrogenic differentiation

Chondrogenic differentiation was modified through previously reported [ 23 ]. For three-dimensional pellet tradition, CG-stimulated ASCs were resuspended in defined chondrogenic difference medium (CDM; high-glucose DMEM supplemented with 1% FBS, 1% ITS  +  Premix, 100 nM dexamethasone, 1× MEM Non-Essential Amino Acid solution, 50  μ g/mL  L-proline, and 1% penicillin/streptomycin). Non-treated cells were resuspended within growth media as a negative control. As a positive manage, non-treated cells in a 15  mL conical tube had been resuspended in CDM containing 10  ng/mL TGF-β one The tube was placed in an upright position, plus cells were incubated at 37  ° C in the humidified incubator containing 5% CO 2 . The medium was changed every 2 or 3  days for 2– 3 weeks. L-ascorbic acid 2-phosphate has a short half-life, therefore it was provided at the focus of 50 ug/ml every media change [ 24 , 25 ].

Cell viability assay

Tissues stimulated with or without CG were seeded onto a 96-well plate. After 24  h, cell viability was researched using CCK-8 solution (Dojindo Molecular Technologies, Rockville, MARYLAND, USA) according to the manufacturer’ s manual. Briefly, CCK-8 answer was added to each well to a final concentration associated with 10%. After incubation for 4  h, absorbance has been measured at 450  nm using an ELISA reader (VersaMax, Molecular Devices, Sunnyvale, CA, USA).

Histological evaluation

The pelleted cells had been harvested and then histologically analyzed at 21  days. Micromass pellets were washed twice with 1× phosphate-buffered saline (PBS) and fixed for 24  h in 10% formalin. After fixation, micromass pellets were paraffin-embedded plus sectioned (5  μ m thick). Micromass pellet areas were deparaffinized, rehydrated, and then washed with PBS. In order to validate chondrogenic differentiation, sectioned micromasses were stained along with 1% Safranin O solution or 3% Alcian Glowing blue for 10  min and counterstained with hematoxylin plus eosin solution (Sigma-Aldrich, St . Louis, MO, USA) [ 23 ]. The sections were mounted, and images had been acquired using an inverted fluorescence microscope (IX-71, Olympus, Middle Valley, PA, USA).

Immunofluorescence assay

Rehydrated micromass pellet sections were deparaffinized, rehydrated, and washed twice in buffer. The 35mm slides were incubated in 3% H 2 O 2 (prepared in 1× PBS) for 15  min and washed with plain tap water for 15  min. The slides were blocked along with blocking buffer (10% normal goat serum prepared within PBS) for 1  h [ 26 ]. Anti-collagen kind II (COL2A1) (1: 100; Abcam, Cambridge, MA, USA) and anti-aggrecan (ACAN) (1: 200; GeneTex, Irvine, CALIFORNIA, USA) primary antibodies were applied and incubated based on the manufacturer’ s recommended protocol, and the slides were cleaned four times in buffer. The slides were incubated with a fluorochrome-conjugated secondary antibody diluted in 5% regular goat serum for 1  h at room temp in the dark and then washed three times in 1× PBS meant for 5  min each in the dark. The slides were incubated with DAPI (1  μ g/mL; Molecular Probes, Waltham, MA, USA) for 10  min, washed twice along with 1× PBS for 5  min each, and then visualized using fluorescence microscopy.

Quantitative and semi-quantitative PCR evaluation

Total RNA was taken out from stem cells with or without CG stimulation using TRIzol reagent (Invitrogen, Waltham, MA, USA) according to the manufacturer’ ersus protocol. Total RNA (1  μ g) was reverse-transcribed using a RevertAid™ First Strand cDNA Synthesis Kit (Fermentas, Burlington, ON, Canada). For quantitative real-time PCR, cDNA (25  ng) was amplified using SYBR® Green PCR Master Mix (Applied Biosystems, Carlsbad, CA, USA). Primers for GAPDH (P267613), SRY (sex-determining region Y)-box (SOX) 5 (P209528), 5′ -AACAAGCACA GATCCCCATTG(dTdT)-3′ (sense) and 5′ -ACACCGTAAGTGCTCTGGATA(dTdT)-3′ (antisense), SOX6 (P14 2525), 5′ – AAGGCTAAAGGGCCTAAGTGA(dTdT)-3′ (sense) and 5′ – TTGATGGCATCTTTGCTCCAG(dTd T)-3′ (antisense) SOX9 (P232240), 5′ – CCACCTTCACCTACATGAACC(dTdT)-3′ (sense) and 5′ -CTGTGTGT AGACGGGTTGTTC(dTdT)-3′ (antisense) and bone morphogenetic protein (BMP) four (P196415) 5′ -GACACGG TGGGAAACTTTTGA(dTdT)-3′ (sense) and 5′ -GGTAACGATCGGCTAATCCTG(dTdT)-3′ (antisense) were purchased from Bioneer (Daejeon, South Korea). Real-time PCR was performed using a real-time system (Roche, Indianapolis, IN, USA). Mean cycle threshold values through triplicate experiments were used to calculate gene expression normalized to GAPDH as an internal control. For semi-quantitative PCR, 25  ng of cDNA was amplified using Taq polymerase and designed primers. The primer sequences had been as follows: COL2A1, 5′ -GGCAATAGCAGGTTCACGTACA-3′ (sense) and 5′ -CGATAACAGTCTTGCCCCACTT-3′ (antisense); ACAN, 5′ -GTGCCTATCAGGACAAGGTCT-3′ (sense) and 5′ -GATGCCTTTCACCACGACTTC-3′ (antisense); BMP2, 5′ -CCCAGCGTGAAAAGAGAGAC-3′ (sense) and 5′ -GAGACCGCAGTCCGTCTAAG-3′ (antisense); COL1A1, 5′ -CCCCTGGAAAGAATGGAGATG-3′ (sense) and 5′ -TCCAAACCACTGAAACCTC TG-3′ (antisense); COL10A1, 5′ -CAGTCATGCCTGAGGGTTTT-3′ (sense) and 5′ -GGGTCATAATGCTGTTG CCT-3′ (antisense); and TGF-β 1, 5′ -TCCTGCTTCTCATGGCCA-3′ (sense) and 5′ -CCTCAGCTGCACTTGTA G-3′ (antisense). The regarding RT-PCR bands was quantified using ImageJ (1. 40).

Western blot analysis

Meant for protein extraction, whole cells were lysed in RIPA buffer (50  mM Tris, pH  7. 4, 150  mM NaCl, 5  mM EDTA, 30  mM NaF, 1  mM Na 3 VO 4 , 0. 1  mM PMSF, protease blockers, and 1% Nonidet-P40). The supernatant was harvested plus concentrated using a Vivaspin Turbo 15 (Sartorius Stedim, Gottingen, Germany). For normalization, the same number of cells was finished after CG loading or without CG loading intended for control, and the GAPDH expression of each condition was looked into using western blot analysis. Protein lysates (30  μ g) and concentrated supernatants were resolved by 10– 12% SDS-PAGE, transferred to polyvinylidene difluoride membranes (Amersham Pharmacia Biotech, Piscataway, NJ, USA), and then probed with major antibodies against SOX9 (EMD Millipore, Billerica, MA, USA), BMP4 (Santa Cruz Biotechnology, Inc., Dallas, Texas USA), and GAPDH (Abcam). After extensive washing, primary antibodies were detected by peroxidase-linked IgG (1: 5000; Abcam) and visualized using an ECL kit (WESTSAVE GOLD, AbFrontier, Geumcheon-gu, Seoul, South Korea). The intensity of western mark bands was quantified using ImageJ (1. 40).

Record analysis

All experiments had been separately performed at least three times. Statistical analysis was carried out using an one-way analysis of variance (ANOVA) with blog post hoc Bonferroni correction. The statistical comparison at the same time factors between two groups was performed using two-way ANOVA. Data are presented as the mean  ±   regular deviation. For all tests, l   <   0. 05 was considered to become statistically significant.